Skip to main content

Restriction MAP Calculator

Calculate restriction map with our free science calculator. Uses standard scientific formulas with unit conversions and explanations.

Skip to calculator
Biology

Restriction MAP Calculator

Find restriction enzyme recognition sites in DNA sequences. Calculate fragment sizes, visualize cut positions, and plan digestion experiments for molecular cloning.

Last updated: December 2025

Calculator

Adjust values & calculate
Total Cut Sites
4
5 fragments from 52 bp linear DNA

Enzyme Results

EcoRIGAATTC
3 sites
Positions: 4, 18, 42
BamHIGGATCC
1 site
Positions: 29

Fragment Sizes (sorted)

#1
14 bp
#2
13 bp
#3
11 bp
#4
10 bp
#5
4 bp
Largest Fragment
14 bp
Smallest Fragment
4 bp
Your Result
4 cut sites | 5 fragments | Largest: 14 bp
Share Your Result
Understand the Math

Formula

Fragments (linear) = Cut sites + 1; Fragments (circular) = Cut sites

For linear DNA, each restriction cut divides a fragment into two, so n cuts produce n+1 fragments. For circular DNA (plasmids), n cuts produce exactly n fragments since there are no free ends. Fragment sizes are determined by the distances between consecutive cut positions.

Last reviewed: December 2025

Worked Examples

Example 1: EcoRI Digestion of a Plasmid Insert

A 50 bp linear DNA fragment ATCGAATTCGATCGATCGAATTCGATCGGGATCCATCGATCGAATTCGATCG contains EcoRI (GAATTC) sites. How many fragments result?
Solution:
Scan for GAATTC in the sequence: Position 4: GAATTC (cut at position 5) Position 19: GAATTC (cut at position 20) Position 42: GAATTC (cut at position 43) 3 cut sites in linear DNA = 4 fragments Fragment sizes: 5, 15, 23, and 7 bp
Result: 3 EcoRI sites found, producing 4 fragments (5, 7, 15, 23 bp)

Example 2: Double Digest with EcoRI and BamHI

The same 50 bp sequence also contains a BamHI site (GGATCC). Perform a double digest.
Solution:
EcoRI sites at positions 4, 19, 42 (3 cuts) BamHI site at position 28 (1 cut) Total: 4 unique cut positions Linear DNA: 4 cuts = 5 fragments Fragments sorted by size from cut positions.
Result: 4 total cuts (3 EcoRI + 1 BamHI) = 5 fragments for gel analysis
Expert Insights

Background & Theory

The Restriction MAP Calculator applies the following established principles and formulas. Biology is the scientific study of life, encompassing the structure, function, growth, evolution, and distribution of living organisms. At the cellular level, all life is composed of cells, the basic structural and functional units of organisms. Prokaryotic cells lack a membrane-bound nucleus, while eukaryotic cells possess a nucleus and membrane-bound organelles including mitochondria, which generate ATP through oxidative phosphorylation, and ribosomes, which synthesize proteins. Genetics quantifies the inheritance of traits. Gregor Mendel's laws describe how alleles segregate during gamete formation and assort independently for genes on different chromosomes. Punnett squares provide a visual method for calculating the probability of offspring genotypes and phenotypes from known parental genotypes. For a monohybrid cross of two heterozygotes (Aa ร— Aa), the expected phenotypic ratio is 3 dominant to 1 recessive. The Hardy-Weinberg equilibrium principle states that allele and genotype frequencies in a population remain constant from generation to generation in the absence of evolutionary forces. If p and q are the frequencies of two alleles at a locus, then p + q = 1 and genotype frequencies are pยฒ, 2pq, and qยฒ for the three possible genotypes. Deviations from equilibrium signal the action of natural selection, genetic drift, mutation, migration, or non-random mating. Population growth follows two primary models. Exponential growth, N = Nโ‚€eสณแต—, describes unlimited growth where Nโ‚€ is the initial population, r is the intrinsic rate of increase, and t is time. Logistic growth incorporates carrying capacity K, describing how growth slows as population approaches the environment's maximum sustainable size: dN/dt = rN(1 โˆ’ N/K). Enzyme kinetics describes the rate of enzyme-catalyzed reactions. The Michaelis-Menten equation, v = Vmax[S]/(Km + [S]), relates reaction velocity v to substrate concentration [S], maximum velocity Vmax, and the Michaelis constant Km, which equals the substrate concentration at half-maximal velocity. DNA replication relies on complementary base pairing: adenine pairs with thymine (two hydrogen bonds) and guanine with cytosine (three hydrogen bonds), ensuring faithful copying of genetic information.

History

The history behind the Restriction MAP Calculator traces back through the following developments. The systematic study of living things began with Aristotle (384โ€“322 BCE), who classified over 500 animal species and wrote foundational texts on anatomy, reproduction, and animal behavior. His scala naturae ranked organisms in a hierarchy from simple to complex and influenced biological thought for two millennia. Theophrastus, his student, applied similar methods to plants. Carl Linnaeus established modern taxonomy in Systema Naturae (1735), introducing the binomial nomenclature system that assigns each organism a genus and species name. His hierarchical classification system โ€” species, genus, family, order, class, phylum, kingdom โ€” provided the organizational framework that biologists still use, now extended to seven ranks and supplemented by cladistics. Charles Darwin and Alfred Russel Wallace independently developed the theory of evolution by natural selection, which Darwin published in On the Origin of Species in 1859. Darwin argued that heritable variation exists within populations, that organisms with advantageous traits survive and reproduce at higher rates, and that this differential reproduction gradually changes the character of populations over generations. This unified all of biology under a single explanatory framework. Gregor Mendel's meticulous pea plant experiments, conducted from 1856 to 1863 and published in 1866, established the particulate nature of inheritance and the laws of segregation and independent assortment. Overlooked until 1900, when three botanists independently rediscovered his work, Mendel's laws laid the foundation for the science of genetics. James Watson and Francis Crick, building on Rosalind Franklin's X-ray crystallography data, determined the double-helix structure of DNA in 1953, revealing the physical basis of heredity and the mechanism by which genetic information is stored and copied. The Human Genome Project, a 13-year international collaboration, published the complete sequence of the human genome in 2003, comprising approximately 3.2 billion base pairs. The development of CRISPR-Cas9 gene editing by Jennifer Doudna, Emmanuelle Charpentier, and colleagues from 2012 onward opened an era of precise genome modification with transformative implications for medicine, agriculture, and basic research.

Share this calculator

Explore More

Frequently Asked Questions

A restriction map is a diagram showing the locations of restriction enzyme recognition sites along a DNA molecule. It is one of the most fundamental tools in molecular biology, used for cloning strategy design, vector construction, and DNA fingerprinting. By digesting DNA with known restriction enzymes and analyzing fragment sizes on agarose gels, researchers can verify plasmid constructs, map gene locations, and plan subcloning experiments. Restriction maps were historically the first step in characterizing unknown DNA before sequencing became affordable.
Restriction enzymes (restriction endonucleases) are bacterial proteins that recognize specific palindromic DNA sequences and cleave the phosphodiester backbone at precise positions. Type II restriction enzymes (used in cloning) cut within or near their recognition site. For example, EcoRI recognizes GAATTC and cuts between G and AATTC on both strands, creating 4-nucleotide 5-prime overhangs called sticky ends. Some enzymes like SmaI cut at the center of their recognition site creating blunt ends. The position and type of cut determines which fragments can be ligated together during cloning.
For linear DNA, the number of fragments equals the number of cut sites plus one, because the two ends of the molecule create additional fragment boundaries. For circular DNA (like plasmids), the number of fragments equals exactly the number of cut sites, because the molecule has no free ends. A single cut in a circular plasmid linearizes it into one fragment. Two cuts produce two fragments. This distinction is critical when predicting gel patterns. A 5 kb circular plasmid cut once gives a single 5 kb band, while cutting the same sequence if it were linear gives two fragments whose sizes sum to 5 kb.
Selecting restriction enzymes for cloning requires checking several criteria. First, the enzymes should cut at the desired insert boundaries but not internally within the insert or vector backbone. Second, the two enzymes should produce compatible but non-identical ends for directional cloning. Third, both enzymes should be active in a common buffer at the same temperature. Fourth, methylation sensitivity must be considered since some enzymes are blocked by Dam or Dcm methylation in E. coli. Finally, ensure adequate flanking sequence outside the recognition site for efficient cutting near DNA ends, typically requiring 4-6 extra base pairs beyond the recognition sequence.
You may use the results for reference and educational purposes. For professional reports, academic papers, or critical decisions, we recommend verifying outputs against peer-reviewed sources or consulting a qualified expert in the relevant field.
All calculations use established mathematical formulas and are performed with high-precision arithmetic. Results are accurate to the precision shown. For critical decisions in finance, medicine, or engineering, always verify results with a qualified professional.
Educational Note: This calculator is provided for educational and informational purposes. Results are based on the formulas and inputs provided. Always verify important calculations independently. NovaCalculator processes calculator inputs client-side; optional analytics follow visitor consent settings. ยฉ 2024โ€“2026 NovaCalculator.

Share this calculator

Formula

Fragments (linear) = Cut sites + 1; Fragments (circular) = Cut sites

For linear DNA, each restriction cut divides a fragment into two, so n cuts produce n+1 fragments. For circular DNA (plasmids), n cuts produce exactly n fragments since there are no free ends. Fragment sizes are determined by the distances between consecutive cut positions.

Frequently Asked Questions

What is a restriction map and why is it important?

A restriction map is a diagram showing the locations of restriction enzyme recognition sites along a DNA molecule. It is one of the most fundamental tools in molecular biology, used for cloning strategy design, vector construction, and DNA fingerprinting. By digesting DNA with known restriction enzymes and analyzing fragment sizes on agarose gels, researchers can verify plasmid constructs, map gene locations, and plan subcloning experiments. Restriction maps were historically the first step in characterizing unknown DNA before sequencing became affordable.

How do restriction enzymes cut DNA?

Restriction enzymes (restriction endonucleases) are bacterial proteins that recognize specific palindromic DNA sequences and cleave the phosphodiester backbone at precise positions. Type II restriction enzymes (used in cloning) cut within or near their recognition site. For example, EcoRI recognizes GAATTC and cuts between G and AATTC on both strands, creating 4-nucleotide 5-prime overhangs called sticky ends. Some enzymes like SmaI cut at the center of their recognition site creating blunt ends. The position and type of cut determines which fragments can be ligated together during cloning.

How does circular vs linear DNA affect the restriction map?

For linear DNA, the number of fragments equals the number of cut sites plus one, because the two ends of the molecule create additional fragment boundaries. For circular DNA (like plasmids), the number of fragments equals exactly the number of cut sites, because the molecule has no free ends. A single cut in a circular plasmid linearizes it into one fragment. Two cuts produce two fragments. This distinction is critical when predicting gel patterns. A 5 kb circular plasmid cut once gives a single 5 kb band, while cutting the same sequence if it were linear gives two fragments whose sizes sum to 5 kb.

How do I choose the right restriction enzymes for cloning?

Selecting restriction enzymes for cloning requires checking several criteria. First, the enzymes should cut at the desired insert boundaries but not internally within the insert or vector backbone. Second, the two enzymes should produce compatible but non-identical ends for directional cloning. Third, both enzymes should be active in a common buffer at the same temperature. Fourth, methylation sensitivity must be considered since some enzymes are blocked by Dam or Dcm methylation in E. coli. Finally, ensure adequate flanking sequence outside the recognition site for efficient cutting near DNA ends, typically requiring 4-6 extra base pairs beyond the recognition sequence.

Why might my result differ from another tool or reference?

Differences typically arise from rounding conventions, the specific version of a formula (for example, simple vs compound interest), or unit inconsistencies between inputs. Check that both tools are using the same formula variant and the same units. The References section links to the authoritative source behind the formula used here.

How accurate are the results from Restriction MAP Calculator?

All calculations use established mathematical formulas and are performed with high-precision arithmetic. Results are accurate to the precision shown. For critical decisions in finance, medicine, or engineering, always verify results with a qualified professional.

References

Reviewed by Daniel Agrici, Founder & Lead Developer ยท Editorial policy