Restriction MAP Calculator
Calculate restriction map with our free science calculator. Uses standard scientific formulas with unit conversions and explanations.
Reviewed for accuracy by Daniel Agrici, Founder & Lead Developer
Restriction MAP Calculator
Calculator
Adjust values & calculateEnter your values below. Every result is computed in your browser โ no data is sent to any server.
Formula: Fragments (linear) = Cut sites + 1; Fragments (circular) = Cut sites
Worked example โ 3 EcoRI sites found, producing 4 fragments (5, 7, 15, 23 bp)
Formula
Fragments (linear) = Cut sites + 1; Fragments (circular) = Cut sites
For linear DNA, each restriction cut divides a fragment into two, so n cuts produce n+1 fragments. For circular DNA (plasmids), n cuts produce exactly n fragments since there are no free ends. Fragment sizes are determined by the distances between consecutive cut positions.
Worked Examples
Example 1: EcoRI Digestion of a Plasmid Insert
Problem:A 50 bp linear DNA fragment ATCGAATTCGATCGATCGAATTCGATCGGGATCCATCGATCGAATTCGATCG contains EcoRI (GAATTC) sites. How many fragments result?
Solution:Scan for GAATTC in the sequence: Position 4: GAATTC (cut at position 5) Position 19: GAATTC (cut at position 20) Position 42: GAATTC (cut at position 43) 3 cut sites in linear DNA = 4 fragments Fragment sizes: 5, 15, 23, and 7 bp
Result:3 EcoRI sites found, producing 4 fragments (5, 7, 15, 23 bp)
Example 2: Double Digest with EcoRI and BamHI
Problem:The same 50 bp sequence also contains a BamHI site (GGATCC). Perform a double digest.
Solution:EcoRI sites at positions 4, 19, 42 (3 cuts) BamHI site at position 28 (1 cut) Total: 4 unique cut positions Linear DNA: 4 cuts = 5 fragments Fragments sorted by size from cut positions.
Result:4 total cuts (3 EcoRI + 1 BamHI) = 5 fragments for gel analysis
Frequently Asked Questions
What is a restriction map and why is it important?
A restriction map is a diagram showing the locations of restriction enzyme recognition sites along a DNA molecule. It is one of the most fundamental tools in molecular biology, used for cloning strategy design, vector construction, and DNA fingerprinting. By digesting DNA with known restriction enzymes and analyzing fragment sizes on agarose gels, researchers can verify plasmid constructs, map gene locations, and plan subcloning experiments. Restriction maps were historically the first step in characterizing unknown DNA before sequencing became affordable.
How do restriction enzymes cut DNA?
Restriction enzymes (restriction endonucleases) are bacterial proteins that recognize specific palindromic DNA sequences and cleave the phosphodiester backbone at precise positions. Type II restriction enzymes (used in cloning) cut within or near their recognition site. For example, EcoRI recognizes GAATTC and cuts between G and AATTC on both strands, creating 4-nucleotide 5-prime overhangs called sticky ends. Some enzymes like SmaI cut at the center of their recognition site creating blunt ends. The position and type of cut determines which fragments can be ligated together during cloning.
What is the difference between single and double digestion?
Single digestion uses one restriction enzyme to cut DNA, producing fragments whose number equals the number of cut sites plus one (for linear DNA). Double digestion uses two enzymes simultaneously, potentially producing more and smaller fragments. Double digestion is essential for directional cloning, where an insert is cut with two different enzymes to ensure it can only ligate into the vector in one orientation. When planning a double digest, it is important to verify that both enzymes are active in the same buffer conditions and at the same temperature, which is why tools like NEB DoubleDigest Finder exist.
How does circular vs linear DNA affect the restriction map?
For linear DNA, the number of fragments equals the number of cut sites plus one, because the two ends of the molecule create additional fragment boundaries. For circular DNA (like plasmids), the number of fragments equals exactly the number of cut sites, because the molecule has no free ends. A single cut in a circular plasmid linearizes it into one fragment. Two cuts produce two fragments. This distinction is critical when predicting gel patterns. A 5 kb circular plasmid cut once gives a single 5 kb band, while cutting the same sequence if it were linear gives two fragments whose sizes sum to 5 kb.
How do I choose the right restriction enzymes for cloning?
Selecting restriction enzymes for cloning requires checking several criteria. First, the enzymes should cut at the desired insert boundaries but not internally within the insert or vector backbone. Second, the two enzymes should produce compatible but non-identical ends for directional cloning. Third, both enzymes should be active in a common buffer at the same temperature. Fourth, methylation sensitivity must be considered since some enzymes are blocked by Dam or Dcm methylation in E. coli. Finally, ensure adequate flanking sequence outside the recognition site for efficient cutting near DNA ends, typically requiring 4-6 extra base pairs beyond the recognition sequence.
References
Background & Theory
History
Reviewed for accuracy by Daniel Agrici, Founder & Lead Developer ยท Editorial policy
Related Calculators
๐งฎAlpaca Gestation Calculator
Calculate alpaca gestation with inputs, formulas, and instant results.
๐งฎCat Pregnancy Calculator โ Due Date & Gestation
Calculate cat pregnancy with inputs, formulas, and instant results.
๐งฎCow Gestation Calculator
Calculate cow gestation with inputs, formulas, and instant results.
๐งฎDog Pregnancy Calculator: Due Date by Breed
Calculate dog pregnancy with inputs, formulas, and instant results.
๐งฎGoat Gestation Calculator
Calculate goat gestation with inputs, formulas, and instant results.
๐งฎGuinea Pig Pregnancy Calculator โ Due Date
Calculate guinea pig pregnancy with inputs, formulas, and instant results.
๐งฎLlama Gestation Calculator
Calculate llama gestation with inputs, formulas, and instant results.
๐งฎMare Gestation Calculator
Calculate mare gestation with inputs, formulas, and instant results.