Melting Temperature Calculator
Compute melting temperature using validated scientific equations. See step-by-step derivations, unit analysis, and reference values.
Reviewed for accuracy by Daniel Agrici, Founder & Lead Developer
Melting Temperature Calculator
Calculator
Adjust values & calculateEnter your values below. Every result is computed in your browser โ no data is sent to any server.
Formula: Tm = (dH * 1000) / (dS + R * ln(Ct/4)) - 273.15 + salt correction
Worked example โ Basic: 60.0 C | Salt-adjusted: 55.3 C | Nearest-Neighbor: 49.6 C
Formula
Tm = (dH * 1000) / (dS + R * ln(Ct/4)) - 273.15 + salt correction
Where dH is the total enthalpy change (kcal/mol) from nearest-neighbor stacking parameters, dS is the total entropy change (cal/mol*K), R is the gas constant (1.987 cal/mol*K), Ct is the total primer concentration, and salt correction adjusts for ionic strength using Owczarzy 2004 formula.
Worked Examples
Example 1: Standard PCR Primer Tm Calculation
Problem:Calculate the Tm for the primer ATCGATCGATCGATCGATCG (20 bp) at 50 mM Na+ and 250 nM primer concentration.
Solution:GC content = 10G+C / 20 = 50% Basic method: 2(5+5) + 4(5+5) = 20 + 40 = 60 degrees C Nearest-Neighbor: Sum dH = -145.6 kcal/mol, Sum dS = -398.4 cal/(mol*K) Tm(NN) = dH*1000 / (dS + R*ln(Ct/4)) - 273.15 = ~55.2 degrees C Salt correction: Tm + 7.21*ln(0.05) = ~49.6 degrees C
Result:Basic: 60.0 C | Salt-adjusted: 55.3 C | Nearest-Neighbor: 49.6 C
Example 2: High GC Primer Analysis
Problem:Compare Tm for GCGCGCGCGCGCGCGCGCGC (100% GC, 20bp) vs ATATATATATATATATATA (0% GC, 20bp).
Solution:GC-rich: Basic = 4*20 = 80 C, high stability from triple H-bonds AT-rich: Basic = 2*20 = 40 C, weaker A-T base pairing Difference = 40 degrees C, demonstrating GC impact on duplex stability.
Result:100% GC Tm: ~80 C | 0% GC Tm: ~40 C | GC content is the dominant Tm factor for short oligos
Frequently Asked Questions
What is the melting temperature (Tm) of a DNA primer?
The melting temperature (Tm) is the temperature at which 50% of the DNA primer-template duplexes are dissociated into single strands. It is a critical parameter for designing PCR primers, hybridization probes, and other molecular biology experiments. A higher GC content and longer sequence length generally increase Tm because G-C base pairs have three hydrogen bonds compared to two for A-T pairs. Knowing the accurate Tm helps set proper annealing temperatures for PCR (typically 5 degrees C below Tm) to ensure specific binding while minimizing non-specific amplification.
What is the difference between the Basic, Salt-Adjusted, and Nearest-Neighbor methods?
The Basic method (Wallace rule: Tm = 2(A+T) + 4(G+C)) is a quick approximation suitable only for very short oligonucleotides under 14 bp and does not account for salt concentration or sequence context. The Salt-Adjusted method incorporates sodium ion concentration effects but still treats nucleotides independently. The Nearest-Neighbor (NN) method, based on SantaLucia 1998 thermodynamic parameters, is the most accurate because it considers the stacking interactions between adjacent base pairs, which significantly affect duplex stability. The NN method also accounts for primer concentration and salt conditions, making it the gold standard for primer design.
How does salt concentration affect melting temperature?
Monovalent cations like Na+ stabilize DNA duplexes by neutralizing the negative charges on phosphate backbone groups, reducing electrostatic repulsion between strands. Higher salt concentrations increase Tm because the duplex becomes more thermodynamically stable. A typical PCR buffer contains 50 mM KCl or NaCl. Doubling the salt concentration can increase Tm by approximately 5-7 degrees C. Divalent cations like Mg2+ have an even stronger stabilizing effect. Most Tm calculators use the Owczarzy salt correction formula to adjust the nearest-neighbor Tm for specific ionic conditions.
What is an ideal Tm for PCR primers?
For standard PCR, optimal primer Tm is typically between 55-65 degrees C, with 60 degrees C being a common target. Both forward and reverse primers should have Tm values within 2-3 degrees C of each other to ensure they anneal efficiently at the same temperature. The annealing temperature is usually set 3-5 degrees below the lower Tm of the primer pair. Primers with Tm below 50 degrees C may bind non-specifically, while those above 70 degrees C may be too stable and cause mispriming. For specialized applications like qPCR, a narrower Tm range of 58-62 degrees C is recommended.
How does GC content influence primer design beyond Tm?
GC content affects not only Tm but also primer secondary structure, specificity, and amplification efficiency. Ideal primers have 40-60% GC content. Very high GC content (above 70%) can cause primers to form stable secondary structures (hairpins and self-dimers) that compete with template binding. Low GC content (below 30%) weakens primer-template binding. The 3-prime end of primers should ideally end with G or C (called a GC clamp) to improve binding stability at the extension site. However, more than 3 consecutive G or C residues at the 3-prime end should be avoided as they can promote mispriming at GC-rich regions.
References
Background & Theory
History
Reviewed for accuracy by Daniel Agrici, Founder & Lead Developer ยท Editorial policy
Related Calculators
๐งฎAnnealing Temperature Calculator
Calculate annealing temperature with inputs, formulas, and instant results.
๐งฎCrickets Chirping Thermometer
Estimate outdoor temperature by counting cricket chirps per minute using Dolbear law.
๐งฎAlpaca Gestation Calculator
Calculate alpaca gestation with inputs, formulas, and instant results.
๐งฎCat Pregnancy Calculator โ Due Date & Gestation
Calculate cat pregnancy with inputs, formulas, and instant results.
๐งฎCow Gestation Calculator
Calculate cow gestation with inputs, formulas, and instant results.
๐งฎDog Pregnancy Calculator: Due Date by Breed
Calculate dog pregnancy with inputs, formulas, and instant results.
๐งฎGoat Gestation Calculator
Calculate goat gestation with inputs, formulas, and instant results.
๐งฎGuinea Pig Pregnancy Calculator โ Due Date
Calculate guinea pig pregnancy with inputs, formulas, and instant results.