Skip to main content

Melting Temperature Calculator

Compute melting temperature using validated scientific equations. See step-by-step derivations, unit analysis, and reference values.

Reviewed by Daniel Agrici, Founder & Lead Developer

Reviewed by Daniel Agrici, Founder & Lead Developer

Formula

Tm = (dH * 1000) / (dS + R * ln(Ct/4)) - 273.15 + salt correction

Where dH is the total enthalpy change (kcal/mol) from nearest-neighbor stacking parameters, dS is the total entropy change (cal/mol*K), R is the gas constant (1.987 cal/mol*K), Ct is the total primer concentration, and salt correction adjusts for ionic strength using Owczarzy 2004 formula.

Worked Examples

Example 1: Standard PCR Primer Tm Calculation

Problem:Calculate the Tm for the primer ATCGATCGATCGATCGATCG (20 bp) at 50 mM Na+ and 250 nM primer concentration.

Solution:GC content = 10G+C / 20 = 50%\nBasic method: 2(5+5) + 4(5+5) = 20 + 40 = 60 degrees C\nNearest-Neighbor: Sum dH = -145.6 kcal/mol, Sum dS = -398.4 cal/(mol*K)\nTm(NN) = dH*1000 / (dS + R*ln(Ct/4)) - 273.15 = ~55.2 degrees C\nSalt correction: Tm + 7.21*ln(0.05) = ~49.6 degrees C

Result:Basic: 60.0 C | Salt-adjusted: 55.3 C | Nearest-Neighbor: 49.6 C

Example 2: High GC Primer Analysis

Problem:Compare Tm for GCGCGCGCGCGCGCGCGCGC (100% GC, 20bp) vs ATATATATATATATATATA (0% GC, 20bp).

Solution:GC-rich: Basic = 4*20 = 80 C, high stability from triple H-bonds\nAT-rich: Basic = 2*20 = 40 C, weaker A-T base pairing\nDifference = 40 degrees C, demonstrating GC impact on duplex stability.

Result:100% GC Tm: ~80 C | 0% GC Tm: ~40 C | GC content is the dominant Tm factor for short oligos

Frequently Asked Questions

What is the melting temperature (Tm) of a DNA primer?

The melting temperature (Tm) is the temperature at which 50% of the DNA primer-template duplexes are dissociated into single strands. It is a critical parameter for designing PCR primers, hybridization probes, and other molecular biology experiments. A higher GC content and longer sequence length generally increase Tm because G-C base pairs have three hydrogen bonds compared to two for A-T pairs. Knowing the accurate Tm helps set proper annealing temperatures for PCR (typically 5 degrees C below Tm) to ensure specific binding while minimizing non-specific amplification.

How does salt concentration affect melting temperature?

Monovalent cations like Na+ stabilize DNA duplexes by neutralizing the negative charges on phosphate backbone groups, reducing electrostatic repulsion between strands. Higher salt concentrations increase Tm because the duplex becomes more thermodynamically stable. A typical PCR buffer contains 50 mM KCl or NaCl. Doubling the salt concentration can increase Tm by approximately 5-7 degrees C. Divalent cations like Mg2+ have an even stronger stabilizing effect. Most Tm calculators use the Owczarzy salt correction formula to adjust the nearest-neighbor Tm for specific ionic conditions.

References

Reviewed by Daniel Agrici, Founder & Lead Developer · Editorial policy