Skip to main content

GC Content Calculator for DNA & RNA Sequences

Paste a DNA or RNA sequence to calculate its GC content percentage, base counts, and estimated melting temperature.

Reviewed by Daniel Agrici, Founder & Lead Developer

Reviewed by Daniel Agrici, Founder & Lead Developer

Formula

GC% = (G + C) / (A + T + G + C) x 100

GC content is the proportion of guanine and cytosine bases in a nucleotide sequence expressed as a percentage. Related metrics include GC skew = (G-C)/(G+C), melting temperature (short: Tm = 2(AT) + 4(GC)), and CpG observed/expected ratio = CpG_count / (C_count x G_count / length).

Worked Examples

Example 1: Short Primer Analysis

Problem:Analyze the GC content of a 20-mer PCR primer: ATGCTTGGCAAAGCTGATTC.

Solution:Sequence: ATGCTTGGCAAAGCTGATTC (20 bp)\nA = 4, T = 5, G = 5, C = 6\nGC count: 5 + 6 = 11\nGC% = 11/20 x 100 = 55.0%\nTm (Wallace): 2(9) + 4(11) = 18 + 44 = 62 C\nGC skew: (5-6)/(5+6) = -0.091

Result:GC content: 55.0%, Tm: 62 C, suitable for standard PCR

Example 2: Comparing Two Sequences

Problem:Compare GC content of AAATTTAAATTT (AT-rich) vs GGCCGGCCGGCC (GC-rich).

Solution:Sequence 1: AAATTTAAATTT\nGC = 0, AT = 12, GC% = 0%\nTm = 2(12) + 4(0) = 24 C\n\nSequence 2: GGCCGGCCGGCC\nGC = 12, AT = 0, GC% = 100%\nTm = 2(0) + 4(12) = 48 C

Result:AT-rich: 0% GC, Tm 24 C | GC-rich: 100% GC, Tm 48 C (24 C difference)

Frequently Asked Questions

What is GC content and why is it important?

GC content is the percentage of nucleotides in a DNA or RNA molecule that are either guanine (G) or cytosine (C). It is one of the most fundamental properties of any nucleic acid sequence. GC content matters because G-C base pairs have three hydrogen bonds compared to two for A-T pairs, making GC-rich regions more thermally stable. GC content varies dramatically between organisms: from about 13% in Plasmodium falciparum to 75% in some Streptomyces species. Within a genome, GC content varies regionally and correlates with gene density, recombination rates, and evolutionary pressures.

How does GC content affect melting temperature?

The melting temperature (Tm) is the temperature at which 50% of DNA duplexes denature into single strands. Higher GC content increases Tm because G-C pairs are held together by three hydrogen bonds (vs two for A-T) and have stronger stacking interactions. For short oligonucleotides (<14 bp), the Wallace rule approximates Tm = 2(A+T) + 4(G+C). For longer sequences, more sophisticated formulas incorporate salt concentration and sequence length. Understanding Tm is essential for PCR primer design, hybridization experiments, and probe design in molecular biology. A typical 20-mer primer with 50% GC has a Tm around 60 degrees C.

How does DNA replication work?

DNA replication is semi-conservative: each strand serves as a template. Helicase unwinds the double helix, primase adds RNA primers, DNA polymerase III synthesizes new strands (5' to 3'), and ligase joins Okazaki fragments on the lagging strand. The result is two identical DNA molecules.

References

Reviewed by Daniel Agrici, Founder & Lead Developer ยท Editorial policy