Skip to main content

Dnato Protein Translator Calculator

Our bioinformatics calculator computes dnato protein translator accurately. Enter measurements for results with formulas and error analysis.

Reviewed by Daniel Agrici, Founder & Lead Developer

Reviewed by Daniel Agrici, Founder & Lead Developer

Formula

DNA -> mRNA (T->U) -> Codons (triplets) -> Amino Acids

Translation reads mRNA in triplets (codons) starting from the selected reading frame. Each codon maps to one of 20 amino acids or a stop signal using the standard genetic code. AUG encodes methionine and serves as the universal start codon. UAA, UAG, and UGA are stop codons that terminate translation.

Worked Examples

Example 1: Simple Coding Sequence

Problem:Translate the DNA sequence ATGCTTGGCAAAGCTGATTAA to protein.

Solution:DNA: ATG CTT GGC AAA GCT GAT TAA\nRNA: AUG CUU GGC AAA GCU GAU UAA\nCodons: AUG(M) CUU(L) GGC(G) AAA(K) GCU(A) GAU(D) UAA(*)\nProtein: MLGKAD\n6 amino acids + 1 stop codon\nMW: 57+113+71+128+115+18 = ~620 Da

Result:Protein: MLGKAD* (6 residues, ~620 Da, 1 ORF)

Example 2: Multi-ORF Sequence

Problem:Translate ATGAAATAAATGGCCTGA in reading frame 1.

Solution:Codons: AUG(M) AAA(K) UAA(*) AUG(M) GCC(A) UGA(*)\nTwo ORFs found:\nORF 1: MK (2 aa, positions 1-2)\nORF 2: MA (2 aa, positions 4-5)\nBoth are short ORFs, likely non-coding

Result:Protein: MK*MA* (2 ORFs found, both short)

Frequently Asked Questions

How does DNA to protein translation work?

DNA to protein translation is a two-step biological process. First, DNA is transcribed into messenger RNA (mRNA) by RNA polymerase, converting thymine (T) to uracil (U). Then, ribosomes read the mRNA in groups of three nucleotides called codons. Each codon specifies one of 20 amino acids or a stop signal. Translation begins at the start codon AUG (methionine) and continues until a stop codon (UAA, UAG, or UGA) is reached. Dnato Protein Translator Calculator simulates the translation step by converting your DNA/RNA sequence directly to the corresponding protein sequence using the standard genetic code.

How is protein molecular weight estimated?

Protein molecular weight is calculated by summing the monoisotopic masses of individual amino acid residues and subtracting water molecules lost during peptide bond formation. Each amino acid has a characteristic residue weight (glycine: 57 Da, tryptophan: 186 Da). For a protein of N amino acids, the formula is MW = sum of residue weights + 18.02 (water). This gives an approximate molecular weight. Actual molecular weights may differ due to post-translational modifications (phosphorylation, glycosylation), disulfide bonds, or non-standard amino acids. Typical proteins range from 5,000 Da (small peptides) to over 500,000 Da (large complexes).

What is the significance of protein isoelectric point?

The isoelectric point (pI) is the pH at which a protein carries no net electrical charge. It is determined by the ionizable side chains of amino acids, particularly aspartic acid, glutamic acid (negative), lysine, arginine, and histidine (positive). Proteins with more basic residues (K, R, H) have higher pI values and are positively charged at physiological pH. Proteins with more acidic residues (D, E) have lower pI values. The pI is crucial for protein purification by isoelectric focusing and ion exchange chromatography. Most cellular proteins have pI values between 5 and 9.

References

Reviewed by Daniel Agrici, Founder & Lead Developer ยท Editorial policy