Skip to main content

Codon Adaptation Index Calculator

Free Codon adaptation index Calculator for bioinformatics. Enter variables to compute results with formulas and detailed steps.

Skip to calculator
Biology

Codon Adaptation Index Calculator

Calculate the Codon Adaptation Index (CAI) for DNA sequences. Analyze codon usage bias, GC content, rare codons, and expression optimization for E. coli, human, and yeast.

Last updated: December 2025

Calculator

Adjust values & calculate

Enter coding sequence starting with ATG. Non-ATGCU characters are removed.

Codon Adaptation Index
0.6256
Moderate - adequate expression expected
GC Content
33.3%
GC3 Content
35.7%
Total Codons
14
Rare Codons
0 (0.0%)
Nc Estimate
33.7
Seq Length
42 bp

Most Frequent Codons

AAA2x (14.3%)
TTT2x (14.3%)
ATG1x (7.1%)
GCA1x (7.1%)
ATT1x (7.1%)
Note: This calculator uses simplified codon usage reference tables for educational purposes. For research applications, use organism-specific codon usage tables from the Kazusa or GenBank databases with your complete coding sequence.
Your Result
CAI: 0.6256 (62.6%) | Codons: 14 | GC: 33.3%
Share Your Result
Understand the Math

Formula

CAI = exp((1/L) * sum(ln(w_i)))

Where L is the number of codons in the sequence (excluding stop codons), w_i is the relative adaptiveness of each codon (ratio of codon frequency to the maximum frequency among synonymous codons in highly expressed genes), and the calculation takes the geometric mean of all w_i values.

Last reviewed: December 2025

Worked Examples

Example 1: E. coli Gene CAI Analysis

Analyze the codon adaptation of a short E. coli gene fragment: ATGAAAGCAATTTTCGTACTGAAAGGTTTTACCTTTACTGAG
Solution:
Codons: ATG-AAA-GCA-ATT-TTC-GTA-CTG-AAA-GGT-TTT-ACC-TTT-ACT-GAG Look up w values for E. coli: ATG=1.000, AAA=1.000, GCA=0.692, ATT=0.465, TTC=1.000, GTA=0.385, CTG=1.000, AAA=1.000, GGT=1.000, TTT=0.296, ACC=1.000, TTT=0.296, ACT=0.500, GAG=0.259 CAI = exp(mean(ln(w_i))) = exp(mean of all log values) Geometric mean calculation yields CAI value
Result: CAI: ~0.61 | 14 codons | GC%: ~40% | Moderate optimization

Example 2: Human Codon Optimization Check

Check if the same sequence ATGAAAGCAATTTTCGTACTGAAAGGTTTTACCTTTACTGAG is well-adapted for human expression.
Solution:
Codons: ATG-AAA-GCA-ATT-TTC-GTA-CTG-AAA-GGT-TTT-ACC-TTT-ACT-GAG Look up w values for Human: ATG=1.000, AAA=0.432, GCA=0.583, ATT=0.536, TTC=1.000, GTA=0.167, CTG=1.000, AAA=0.432, GGT=0.333, TTT=0.458, ACC=1.000, TTT=0.458, ACT=0.560, GAG=1.000 Geometric mean of human w values Lower CAI expected due to different codon preferences
Result: CAI: ~0.55 | Human-adapted | Suboptimal - optimization recommended
Expert Insights

Background & Theory

The Codon Adaptation Index Calculator applies the following established principles and formulas. Biology is the scientific study of life, encompassing the structure, function, growth, evolution, and distribution of living organisms. At the cellular level, all life is composed of cells, the basic structural and functional units of organisms. Prokaryotic cells lack a membrane-bound nucleus, while eukaryotic cells possess a nucleus and membrane-bound organelles including mitochondria, which generate ATP through oxidative phosphorylation, and ribosomes, which synthesize proteins. Genetics quantifies the inheritance of traits. Gregor Mendel's laws describe how alleles segregate during gamete formation and assort independently for genes on different chromosomes. Punnett squares provide a visual method for calculating the probability of offspring genotypes and phenotypes from known parental genotypes. For a monohybrid cross of two heterozygotes (Aa ร— Aa), the expected phenotypic ratio is 3 dominant to 1 recessive. The Hardy-Weinberg equilibrium principle states that allele and genotype frequencies in a population remain constant from generation to generation in the absence of evolutionary forces. If p and q are the frequencies of two alleles at a locus, then p + q = 1 and genotype frequencies are pยฒ, 2pq, and qยฒ for the three possible genotypes. Deviations from equilibrium signal the action of natural selection, genetic drift, mutation, migration, or non-random mating. Population growth follows two primary models. Exponential growth, N = Nโ‚€eสณแต—, describes unlimited growth where Nโ‚€ is the initial population, r is the intrinsic rate of increase, and t is time. Logistic growth incorporates carrying capacity K, describing how growth slows as population approaches the environment's maximum sustainable size: dN/dt = rN(1 โˆ’ N/K). Enzyme kinetics describes the rate of enzyme-catalyzed reactions. The Michaelis-Menten equation, v = Vmax[S]/(Km + [S]), relates reaction velocity v to substrate concentration [S], maximum velocity Vmax, and the Michaelis constant Km, which equals the substrate concentration at half-maximal velocity. DNA replication relies on complementary base pairing: adenine pairs with thymine (two hydrogen bonds) and guanine with cytosine (three hydrogen bonds), ensuring faithful copying of genetic information.

History

The history behind the Codon Adaptation Index Calculator traces back through the following developments. The systematic study of living things began with Aristotle (384โ€“322 BCE), who classified over 500 animal species and wrote foundational texts on anatomy, reproduction, and animal behavior. His scala naturae ranked organisms in a hierarchy from simple to complex and influenced biological thought for two millennia. Theophrastus, his student, applied similar methods to plants. Carl Linnaeus established modern taxonomy in Systema Naturae (1735), introducing the binomial nomenclature system that assigns each organism a genus and species name. His hierarchical classification system โ€” species, genus, family, order, class, phylum, kingdom โ€” provided the organizational framework that biologists still use, now extended to seven ranks and supplemented by cladistics. Charles Darwin and Alfred Russel Wallace independently developed the theory of evolution by natural selection, which Darwin published in On the Origin of Species in 1859. Darwin argued that heritable variation exists within populations, that organisms with advantageous traits survive and reproduce at higher rates, and that this differential reproduction gradually changes the character of populations over generations. This unified all of biology under a single explanatory framework. Gregor Mendel's meticulous pea plant experiments, conducted from 1856 to 1863 and published in 1866, established the particulate nature of inheritance and the laws of segregation and independent assortment. Overlooked until 1900, when three botanists independently rediscovered his work, Mendel's laws laid the foundation for the science of genetics. James Watson and Francis Crick, building on Rosalind Franklin's X-ray crystallography data, determined the double-helix structure of DNA in 1953, revealing the physical basis of heredity and the mechanism by which genetic information is stored and copied. The Human Genome Project, a 13-year international collaboration, published the complete sequence of the human genome in 2003, comprising approximately 3.2 billion base pairs. The development of CRISPR-Cas9 gene editing by Jennifer Doudna, Emmanuelle Charpentier, and colleagues from 2012 onward opened an era of precise genome modification with transformative implications for medicine, agriculture, and basic research.

Share this calculator

Explore More

Frequently Asked Questions

The Codon Adaptation Index (CAI) is a quantitative measure of codon usage bias that evaluates how well a gene's codon usage matches the optimal codon preferences of a target organism. Developed by Sharp and Li in 1987, CAI values range from 0 to 1, where 1 indicates that every codon in the gene is the most frequently used codon for its amino acid in highly expressed genes of the organism. A higher CAI generally predicts higher protein expression levels. The index is calculated as the geometric mean of the relative adaptiveness values for all codons in the gene, making it sensitive to the overall pattern of codon usage rather than individual rare codons.
Codon optimization is critical for recombinant protein expression because different organisms have different preferences for which codons encode each amino acid, reflecting differences in tRNA abundance. When a gene from one organism is expressed in another (heterologous expression), rare codons can cause ribosome stalling, premature translation termination, frameshifting errors, and significantly reduced protein yields. By replacing codons with those preferred by the host organism, translation efficiency can increase dramatically, sometimes by 10 to 100 fold. However, codon optimization must be balanced carefully because some rare codons serve important regulatory functions, and overly aggressive optimization can sometimes cause protein misfolding.
You may use the results for reference and educational purposes. For professional reports, academic papers, or critical decisions, we recommend verifying outputs against peer-reviewed sources or consulting a qualified expert in the relevant field.
All calculations use established mathematical formulas and are performed with high-precision arithmetic. Results are accurate to the precision shown. For critical decisions in finance, medicine, or engineering, always verify results with a qualified professional.
No. All calculations run entirely in your browser using JavaScript. No data you enter is ever transmitted to any server or stored anywhere. Your inputs remain completely private.
The Formula section on this page shows the equation used. You can reproduce the calculation manually or in a spreadsheet using those steps. Compare your answer against the worked examples in the Examples section, which use known reference values so you can confirm the calculator is behaving as expected.
Educational Note: This calculator is provided for educational and informational purposes. Results are based on the formulas and inputs provided. Always verify important calculations independently. NovaCalculator processes calculator inputs client-side; optional analytics follow visitor consent settings. ยฉ 2024โ€“2026 NovaCalculator.

Share this calculator

Formula

CAI = exp((1/L) * sum(ln(w_i)))

Where L is the number of codons in the sequence (excluding stop codons), w_i is the relative adaptiveness of each codon (ratio of codon frequency to the maximum frequency among synonymous codons in highly expressed genes), and the calculation takes the geometric mean of all w_i values.

Worked Examples

Example 1: E. coli Gene CAI Analysis

Problem: Analyze the codon adaptation of a short E. coli gene fragment: ATGAAAGCAATTTTCGTACTGAAAGGTTTTACCTTTACTGAG

Solution: Codons: ATG-AAA-GCA-ATT-TTC-GTA-CTG-AAA-GGT-TTT-ACC-TTT-ACT-GAG\nLook up w values for E. coli:\nATG=1.000, AAA=1.000, GCA=0.692, ATT=0.465, TTC=1.000, GTA=0.385, CTG=1.000, AAA=1.000, GGT=1.000, TTT=0.296, ACC=1.000, TTT=0.296, ACT=0.500, GAG=0.259\nCAI = exp(mean(ln(w_i))) = exp(mean of all log values)\nGeometric mean calculation yields CAI value

Result: CAI: ~0.61 | 14 codons | GC%: ~40% | Moderate optimization

Example 2: Human Codon Optimization Check

Problem: Check if the same sequence ATGAAAGCAATTTTCGTACTGAAAGGTTTTACCTTTACTGAG is well-adapted for human expression.

Solution: Codons: ATG-AAA-GCA-ATT-TTC-GTA-CTG-AAA-GGT-TTT-ACC-TTT-ACT-GAG\nLook up w values for Human:\nATG=1.000, AAA=0.432, GCA=0.583, ATT=0.536, TTC=1.000, GTA=0.167, CTG=1.000, AAA=0.432, GGT=0.333, TTT=0.458, ACC=1.000, TTT=0.458, ACT=0.560, GAG=1.000\nGeometric mean of human w values\nLower CAI expected due to different codon preferences

Result: CAI: ~0.55 | Human-adapted | Suboptimal - optimization recommended

Frequently Asked Questions

What is the Codon Adaptation Index (CAI) and what does it measure?

The Codon Adaptation Index (CAI) is a quantitative measure of codon usage bias that evaluates how well a gene's codon usage matches the optimal codon preferences of a target organism. Developed by Sharp and Li in 1987, CAI values range from 0 to 1, where 1 indicates that every codon in the gene is the most frequently used codon for its amino acid in highly expressed genes of the organism. A higher CAI generally predicts higher protein expression levels. The index is calculated as the geometric mean of the relative adaptiveness values for all codons in the gene, making it sensitive to the overall pattern of codon usage rather than individual rare codons.

Why is codon optimization important for recombinant protein expression?

Codon optimization is critical for recombinant protein expression because different organisms have different preferences for which codons encode each amino acid, reflecting differences in tRNA abundance. When a gene from one organism is expressed in another (heterologous expression), rare codons can cause ribosome stalling, premature translation termination, frameshifting errors, and significantly reduced protein yields. By replacing codons with those preferred by the host organism, translation efficiency can increase dramatically, sometimes by 10 to 100 fold. However, codon optimization must be balanced carefully because some rare codons serve important regulatory functions, and overly aggressive optimization can sometimes cause protein misfolding.

How do I interpret the result?

Results are displayed with a label and unit to help you understand the output. Many calculators include a short explanation or classification below the result (for example, a BMI category or risk level). Refer to the worked examples section on this page for real-world context.

Can I use Codon Adaptation Index Calculator on a mobile device?

Yes. All calculators on NovaCalculator are fully responsive and work on smartphones, tablets, and desktops. The layout adapts automatically to your screen size.

How do I get the most accurate result?

Enter values as precisely as possible using the correct units for each field. Check that you have selected the right unit (e.g. kilograms vs pounds, meters vs feet) before calculating. Rounding inputs early can reduce output precision.

What inputs do I need to use Codon Adaptation Index Calculator accurately?

Each field is labelled with the required unit (metric or imperial). Gather your source values before starting โ€” for example, a weight measurement in kilograms, a distance in metres, or a dollar amount โ€” and enter them exactly as measured. The formula section on this page lists every variable and explains what each represents.

References

Reviewed by Daniel Agrici, Founder & Lead Developer ยท Editorial policy