Codon Adaptation Index Calculator
Free Codon adaptation index Calculator for bioinformatics. Enter variables to compute results with formulas and detailed steps.
Reviewed for accuracy by Daniel Agrici, Founder & Lead Developer
Codon Adaptation Index Calculator
Calculator
Adjust values & calculateEnter your values below. Every result is computed in your browser โ no data is sent to any server.
Formula: CAI = exp((1/L) * sum(ln(w_i)))
Worked example โ CAI: ~0.61 | 14 codons | GC%: ~40% | Moderate optimization
Formula
CAI = exp((1/L) * sum(ln(w_i)))
Where L is the number of codons in the sequence (excluding stop codons), w_i is the relative adaptiveness of each codon (ratio of codon frequency to the maximum frequency among synonymous codons in highly expressed genes), and the calculation takes the geometric mean of all w_i values.
Worked Examples
Example 1: E. coli Gene CAI Analysis
Problem:Analyze the codon adaptation of a short E. coli gene fragment: ATGAAAGCAATTTTCGTACTGAAAGGTTTTACCTTTACTGAG
Solution:Codons: ATG-AAA-GCA-ATT-TTC-GTA-CTG-AAA-GGT-TTT-ACC-TTT-ACT-GAG Look up w values for E. coli: ATG=1.000, AAA=1.000, GCA=0.692, ATT=0.465, TTC=1.000, GTA=0.385, CTG=1.000, AAA=1.000, GGT=1.000, TTT=0.296, ACC=1.000, TTT=0.296, ACT=0.500, GAG=0.259 CAI = exp(mean(ln(w_i))) = exp(mean of all log values) Geometric mean calculation yields CAI value
Result:CAI: ~0.61 | 14 codons | GC%: ~40% | Moderate optimization
Example 2: Human Codon Optimization Check
Problem:Check if the same sequence ATGAAAGCAATTTTCGTACTGAAAGGTTTTACCTTTACTGAG is well-adapted for human expression.
Solution:Codons: ATG-AAA-GCA-ATT-TTC-GTA-CTG-AAA-GGT-TTT-ACC-TTT-ACT-GAG Look up w values for Human: ATG=1.000, AAA=0.432, GCA=0.583, ATT=0.536, TTC=1.000, GTA=0.167, CTG=1.000, AAA=0.432, GGT=0.333, TTT=0.458, ACC=1.000, TTT=0.458, ACT=0.560, GAG=1.000 Geometric mean of human w values Lower CAI expected due to different codon preferences
Result:CAI: ~0.55 | Human-adapted | Suboptimal - optimization recommended
Frequently Asked Questions
What is the Codon Adaptation Index (CAI) and what does it measure?
The Codon Adaptation Index (CAI) is a quantitative measure of codon usage bias that evaluates how well a gene's codon usage matches the optimal codon preferences of a target organism. Developed by Sharp and Li in 1987, CAI values range from 0 to 1, where 1 indicates that every codon in the gene is the most frequently used codon for its amino acid in highly expressed genes of the organism. A higher CAI generally predicts higher protein expression levels. The index is calculated as the geometric mean of the relative adaptiveness values for all codons in the gene, making it sensitive to the overall pattern of codon usage rather than individual rare codons.
Why is codon optimization important for recombinant protein expression?
Codon optimization is critical for recombinant protein expression because different organisms have different preferences for which codons encode each amino acid, reflecting differences in tRNA abundance. When a gene from one organism is expressed in another (heterologous expression), rare codons can cause ribosome stalling, premature translation termination, frameshifting errors, and significantly reduced protein yields. By replacing codons with those preferred by the host organism, translation efficiency can increase dramatically, sometimes by 10 to 100 fold. However, codon optimization must be balanced carefully because some rare codons serve important regulatory functions, and overly aggressive optimization can sometimes cause protein misfolding.
How is the CAI calculated mathematically?
CAI is calculated as the geometric mean of relative adaptiveness values for all codons in a coding sequence. First, for each amino acid, the relative adaptiveness (w) of each synonymous codon is calculated by dividing its frequency in highly expressed genes by the frequency of the most common codon for that amino acid. The most preferred codon gets w equal to 1. Then the CAI equals the exponential of the average of natural logarithms of all w values across the gene: CAI equals exp of the sum of ln(wi) divided by L, where L is the number of codons. Stop codons and methionine and tryptophan (which have only one codon each) are typically excluded from the calculation.
What CAI values indicate good versus poor codon optimization?
CAI interpretation depends on the organism, but general guidelines apply across most species. A CAI above 0.8 indicates excellent codon optimization, typical of highly expressed genes like ribosomal proteins and glycolytic enzymes. Values between 0.6 and 0.8 suggest moderate optimization and generally adequate expression levels. CAI values from 0.4 to 0.6 indicate suboptimal codon usage that may limit protein production. Values below 0.4 suggest poor adaptation that could severely impair translation efficiency. For heterologous expression projects, aiming for a CAI above 0.8 in the host organism is recommended, though other factors like mRNA structure and GC content also influence expression levels.
What other factors besides CAI affect gene expression levels?
While CAI is an important predictor, numerous other factors influence gene expression. GC content affects mRNA stability and secondary structure, with extreme values potentially inhibiting translation. The 5-prime untranslated region sequence, including the Shine-Dalgarno sequence in prokaryotes and Kozak sequence in eukaryotes, critically affects translation initiation. mRNA secondary structures near the start codon can block ribosome binding. Codon pair bias, where certain adjacent codon combinations are over or underrepresented, affects translation elongation speed. Promoter strength determines transcription rate. mRNA stability and degradation rates limit steady-state mRNA levels. Protein folding and secretion pathways can create bottlenecks even with efficient translation.
References
Background & Theory
History
Reviewed for accuracy by Daniel Agrici, Founder & Lead Developer ยท Editorial policy
Related Calculators
๐งฎCodon Usage Calculator โ Frequency by Amino Acid
Calculate codon usage with inputs, formulas, and instant results.
๐งฎBiodiversity Index Calculator
Calculate biodiversity index with inputs, formulas, and instant results.
๐งฎShannon Diversity Index Calculator
Calculate shannon diversity index with inputs, formulas, and instant results.
๐งฎSimpson Diversity Index Calculator
Calculate simpson diversity index with inputs, formulas, and instant results.
๐งฎWater Quality Index Calculator
Calculate water quality index with inputs, formulas, and instant results.
๐งฎStand Density Index Calculator
Calculate stand density index with inputs, formulas, and instant results.
๐งฎAlpaca Gestation Calculator
Calculate alpaca gestation with inputs, formulas, and instant results.
๐งฎCat Pregnancy Calculator โ Due Date & Gestation
Calculate cat pregnancy with inputs, formulas, and instant results.