Annealing Temperature Calculator
Free Annealing temperature Calculator for bio laboratory. Enter variables to compute results with formulas and detailed steps.
Reviewed by Daniel Agrici, Founder & Lead Developer
Formula
Tm = delta-H / (delta-S + R x ln(Ct/4)) - 273.15
Where delta-H is the sum of nearest-neighbor enthalpy values, delta-S is the sum of nearest-neighbor entropy values plus initiation parameters, R is the gas constant (1.987 cal/mol/K), and Ct is the total primer concentration. The annealing temperature Ta is typically Tm minus 5 degrees Celsius.
Worked Examples
Example 1: Standard 21-mer Primer Pair
Problem:Calculate the annealing temperature for forward primer ATGCGATCGATCGATCGATCG (21bp) and reverse primer TAGCTAGCTAGCTAGCTAGCT (21bp) at 50 mM Na+, 250 nM primer.
Solution:Forward primer: Length=21, GC=52.4%\nWallace Tm: 2(9A+T) + 4(11G+C) = 18 + 44 = 62C\nNN method Tm: Sum dH and dS for all dinucleotides\nSalt-adjusted Tm (forward): ~59.4C\nSalt-adjusted Tm (reverse): ~55.8C\nLowest Tm: 55.8C\nRecommended Ta: 55.8 - 5 = 50.8C
Result:Recommended annealing temperature: ~50.8C | Touchdown range: 58.8C to 48.8C
Example 2: High GC Content Primer
Problem:Calculate Tm for a GC-rich primer GCGCGCGCGCGCGCGCGCGC (20bp, 100% GC) at standard conditions.
Solution:Length: 20bp, GC content: 100%\nWallace Tm: 2(0) + 4(20) = 80C\nSalt-adjusted Tm: 81.5 + 16.6*log10(0.05) + 41*(1.0) - 600/20\n= 81.5 + (-21.6) + 41 - 30 = 70.9C\nNN method gives higher Tm due to GC stacking\nRecommended Ta: ~65-70C
Result:Very high Tm primer — consider redesigning to lower GC content (40-60%)
Frequently Asked Questions
What is annealing temperature and why is it important in PCR?
The annealing temperature (Ta) is the temperature at which primers bind to the template DNA during the annealing step of PCR (polymerase chain reaction). Choosing the correct annealing temperature is critical for PCR success. If Ta is too high, primers will not bind efficiently, leading to low or no product yield. If Ta is too low, primers may bind non-specifically to incorrect sequences, producing unwanted amplification products, primer dimers, and smeared bands on gels. The optimal Ta is typically 3 to 5 degrees Celsius below the melting temperature (Tm) of the primer-template duplex. Getting this temperature right is one of the most important optimization steps in any PCR experiment and can mean the difference between a clean single band and a failed reaction.
References
Reviewed by Daniel Agrici, Founder & Lead Developer · Editorial policy